Главная Обратная связь

Дисциплины:






Некоторые новые возможности Oniguruma



Oniguruma добавляет много новых возможностей к механизму работы с регулярными выражениями в Ruby. Из самых простых отметим дополнительную управляющую последовательность для указания класса символов. Если \d и \D соответствуют десятичным цифрам и не цифрам, то \h и \H являются аналогами для шестнадцатеричных цифр:

"abc" =~ /\h+/ #0

"DEF" =~ /\h+/ # 0

"abc" =~ /\Н+/ # nil

Добавилось возможностей у классов символов в квадратных скобках. Для организации вложенных классов можно применять оператор &&. Вот как можно записать регулярное выражение, соответствующее любой букве, кроме гласных а, е, i, о, u:

reg1 = /[a-z&&[^aeiou]]/ # Задает пересечение.

А следующее выражение соответствует всему алфавиту, кроме букв от m до p:

reg2 = /[a-z&&[^m-р]]/

Поскольку такие выражения выглядят не очень понятно, рекомендую пользоваться этим средством осмотрительно.

Другие возможности Oniguruma, например оглядывание назад и именованные соответствия, будут рассмотрены ниже. Все связанное с интернационализацией отложим до главы 4.

Позитивное и негативное оглядывание назад

Если заглядывания вперед вам недостаточно, то Oniguruma предлагает еще и оглядывание назад, позволяющее определить, предшествует ли текущему положению заданный образец.

Как и многое другое в регулярных выражениях, эту возможность довольно трудно понять и обосновать. Спасибо Эндрю Джексону за следующий пример.

Предположим, что вам нужно проанализировать некоторую генетическую последовательность (молекула ДНК состоит из четырех основных белков, которые обозначаются А, С, G и T.) Допустим, что мы ищем все неперекрывающиеся цепочки нуклеотидов (длины 4), следующие за T. Нельзя просто попытаться найти T и взять следующие четыре символа, поскольку T может быть последним символом в предыдущем соответствии.

gene = 'GATTACAAACTGCCTGACATACGAA'

seqs = gene.scan(/T(\w{4})/)

# seqs равно: [["TACA"], ["GCCT"], ["ACGA"]]

Ho в этом коде мы пропустили цепочку GACA, которая следует за GCCT. Позитивное оглядывание назад позволит найти все нужные цепочки:

gene = 'GATTACAAACTGCCTGACATACGAA'

seqs = gene.scan(/(?<=T)(\w{4})/)

# seqs равно: [["TACA"], ["GCCT"], ["GACA"], ["ACGA"]]

Следующий пример - небольшая модификация примера, предложенного К. Косако (К. Kosako). Предположим, что есть текст в формате XML (или HTML), и мы хотим перевести в верхний регистр весь текст вне тегов (то есть cdata) Вот как можно сделать это с помощью оглядывания назад:

text =<<-EOF



<body> <h1>This is a heading</h1>

<p> This is a paragraph with some

<i>italics</i> and some <b>boldface</b>

in it...</p>

</body>

EOF

 

pattern = /(?:^| # Начало или...

(?<=>) # текст после '>'

)

([^<]*) # И все символы, кроме '<' (запомнены).

/x

 

puts text.gsub(pattern) {|s| s.upcase }

 

# Вывод:

# <body> <h1>THIS IS A HEADING</h1>

# <p>THIS IS A PARAGRAPH WITH SOME

# <i>ITALICS</i> AND SOME <b>BOLDFACE</b>

# IN IT...</p>

# </body>

Еще о кванторах

Мы уже встречались с атомарными подвыражениями в «классической» библиотеке регулярных выражений в Ruby. Они выделяются с помощью нотации (?>...) и являются «собственническими» в том смысле, что жадные и не допускают возврата внутрь подвыражения.

Oniguruma предлагает еще один способ выразить собственническую природу — с помощью квантора +. Он отличается от метасимвола + в смысле «один или более» и даже может использоваться с ним совместно. (На самом деле это «вторичный» квантор, как и ?, который можно употреблять в таких контекстах, как ??, +? и *?.)

Применение + к повторяющемуся образцу эквивалентно заключению его в скобки как независимого подвыражения, например:

r1 = /x*+/ # То же, что /(?>x*)/

r2 = /x++/ # То же, что /(?>x+)/

r3 = /x?+/ # То же, что /(?>x?)/

По техническим причинам Ruby не считает конструкцию {n,m}+ собственнической.

Понятно, что новый квантор — не более чем удобное обозначение, никакой новой функциональности он не несет.





sdamzavas.net - 2019 год. Все права принадлежат их авторам! В случае нарушение авторского права, обращайтесь по форме обратной связи...